Skip to main content

Table 1 Primer list

From: Thrombomodulin protects against lung damage created by high level of oxygen with large tidal volume mechanical ventilation in rats

Gene name Primer (5′-3′) sequence
IL-1α F: AAGACAAGCCTGTGTTGCTGAAGG
R: TCCCAGAAGAAAATGAGGTCGGTC
IL-1β F: CACCTCTCAAGCAGAGCACAG
R: GGGTTCCATGGTGAAGTCAAC
IL-6 F: TCCTACCCCAACTTCCAATGCTC
R: TTGGATGGTCTTGGTCCTTAGCC
MIP-2 F: CCAACCATCAGGGTACAGGG
R: GGGTCGTCAGGCATTGACA
HMGB-1 F: GGCTGACAAGGCTCGTTATG
R GGGCGGTACTCAGAACAGAA
TNFα F: AAATGGGCTCCCTCTCATCAGTTC
R: TCTGCTTGGTGGTTTGCTACGAC
ROCK-1 F: TCTCATTTGTGCCTTCCTTACG
R: GTTTCCCAAGCCCACTGATC
ACTB F: GACGGTCAGGTCATCACTATCG
R: TAG TTTCATGGATGCCACAGGAT