Skip to main content

Table 1 The sequences of the PCR primers used in this study

From: Sepsis induces incomplete M2 phenotype polarization in peritoneal exudate cells in mice

Target gene   Sequence
TNF-α Forward CTGTAGCCCACGTCGTAGC
Reverse TTGAGATCCATGCCGTTG
IL-1β Forward TGTAATGAAAGACGGCACACC
Reverse TCTTCTTTGGGTATTGCTTGG
IL-6 Forward GAGGATACCACTCCCAACAGACC
Reverse AAGTGCATCATCGTTGTTCATACA
IL-12 p35 Forward CACCCTTGCCCTCCTAAACC
Reverse CACCTGGCAGGTCCAGAGA
IL-10 Forward TGAGGCGCTGTCATCGATTTCTCCC
Reverse ACCTGCTCCACTGCCTTGCT
IL-1ra Forward TCAGATCTGCACTCAATGCC
Reverse CTGGTGTTTGACCTGGGAGT
iNOS Forward ACATCGACCCGTCCACAGTAT
Reverse CAGAGGGGTAGGCTTGTCTC
ARG 1 Forward ATGGAAGAGACCTTCAGCTAC
Reverse GCTGTCTTCCCAAGAGTTGGG
MCP1/CCL2 Forward ACTGAAGCCAGCTCTCTCTTCCTC
Reverse TTCCTTCTTGGGGTCAGCACAGAC
CCL22 Forward GTGGCTCTCGTCCTTCTTGC
Reverse GGACAGTTTATGGAGTAGCTT
CCL24 Forward TGTGACCATCCCCTCATCTTGC
Reverse AAACCTCGGTGCTATTGCCACG
CCL17 Forward TAAGACCTCAGTGGAGTGTTC
Reverse AAATGCCTCAGCGGGAAG
GAPDH Forward TGCACCACCAACTGCTTAG
Reverse GGATGCAGGGATGATGTTC
SOCS1 Forward GTTGTAGCAGCTTGTGTCTG
Reverse TGGTTTGTGCAAAGATACTG
SOCS3 Forward TACTGAGCCGACCTCTCTC
Reverse AGCTGGGTCACTTTCTCATA